cro-miR164-2's details annotation
Protein:
Yellow color--query protein
Green color--interaction proteins.
Interaction line:
Pink--proteins own interaction and positive co-expression relationship with target protein
Blue--proteins own interaction and negative co-expression relationship with target protein
Orange--proteins own interaction and protein-protein relationship with target protein
This network produced by cytoscapeweb

Module annotation (GSEA enrichment result)

Function AnnotationFDRGene Ontolog
Transcription_related, Transcription factor: NAC0.002187408gene family

miiRNA targets

Gene IDExpectionAlign sequence(miRNA-target)Annotation
CRO_T0074481
 ncRNA:21UCGUACACGGGACGAAGAGGU1
   ||||*|||||||||||||||| 
 targets:4014AGCAAGUGCCCUGCUUCUCCA4034
NAC domain containing protein

Expression profilings


Show more details about the miRNA target expression profiles
TOP