cro-miR171-3's details annotation
Protein:
Yellow color--query protein
Green color--interaction proteins.
Interaction line:
Pink--proteins own interaction and positive co-expression relationship with target protein
Blue--proteins own interaction and negative co-expression relationship with target protein
Orange--proteins own interaction and protein-protein relationship with target protein
This network produced by cytoscapeweb

Module annotation (GSEA enrichment result)

Function AnnotationFDRGene Ontolog
transcription, DNA-templated0.000460327GO:0006351
regulation of transcription, DNA-templated0.000621294GO:0006355
cell differentiation0.002058707GO:0030154
transcription factor activity, sequence-specific DNA binding0.022967521GO:0003700
sequence-specific DNA binding0.022967521GO:0043565
Transcription_related, Transcription factor: GRAS6.39E-06gene family

miiRNA targets

Gene IDExpectionAlign sequence(miRNA-target)Annotation
CRO_T0003401.5
 ncRNA:21CUAUAACCGUGCCGAGUUAGU1
   |||||||||=||||||||||| 
 targets:1242GAUAUUGGCGCGGCUCAAUCA1262
GRAS family transcription factor
CRO_T0189401.5
 ncRNA:21CUAUAACCGUGCCGAGUUAGU1
   |||||||||=||||||||||| 
 targets:1925GAUAUUGGCGCGGCUCAAUCA1945
GRAS family transcription factor

Expression profilings


Show more details about the miRNA target expression profiles
TOP