cro-miR395-2's details annotation
Protein:
Yellow color--query protein
Green color--interaction proteins.
Interaction line:
Pink--proteins own interaction and positive co-expression relationship with target protein
Blue--proteins own interaction and negative co-expression relationship with target protein
Orange--proteins own interaction and protein-protein relationship with target protein
This network produced by cytoscapeweb

Module annotation (GSEA enrichment result)

Function AnnotationFDRGene Ontolog
secondary active sulfate transmembrane transporter activity0.000384274GO:0008271
sulfate transmembrane transport0.000384274GO:1902358
integral component of plasma membrane0.004463494GO:0005887

miiRNA targets

Gene IDExpectionAlign sequence(miRNA-target)Annotation
CRO_T0267832
 ncRNA:22CCUCAAGGGGGUUUGUGAAGUC1
   **|||||=|||||||||||||* 
 targets:198UCAGUUCUCCCAAACACUUCAA219
slufate transporter 2;1
CRO_T0267832.5
 ncRNA:22CCUCAAGGGGGUUUGUGAAGUC1
   *||||||||=|||||||||||* 
 targets:132UGAGUUCCCUCAAACACUUCAA153
slufate transporter 2;1

Expression profilings


Show more details about the miRNA target expression profiles
TOP