cro-miR397's details annotation
|
Protein:
Yellow color--query protein
Green color--interaction proteins.
Interaction line:
Pink--proteins own interaction and positive co-expression relationship with target protein
Blue--proteins own interaction and negative co-expression relationship with target protein
Orange--proteins own interaction and protein-protein relationship with target protein |
| This network produced by cytoscapeweb
|
Module annotation (GSEA enrichment result)
| Function Annotation | FDR | Gene Ontolog |
|---|
| hydroquinone:oxygen oxidoreductase activity | 2.63E-35 | GO:0052716 |
| lignin catabolic process | 2.63E-35 | GO:0046274 |
| copper ion binding | 1.59E-32 | GO:0005507 |
| apoplast | 4.75E-29 | GO:0048046 |
| oxidoreductase activity, oxidizing metal ions | 2.56E-26 | GO:0016722 |
| lignin biosynthetic process | 2.39E-24 | GO:0009809 |
| oxidation-reduction process | 3.65E-16 | GO:0055114 |
| aspartyl esterase activity | 0.04002692 | GO:0045330 |
| pectinesterase activity | 0.04002692 | GO:0030599 |
| cell wall modification | 0.041390724 | GO:0042545 |
| single-organism metabolic process | 0.044338418 | GO:0044710 |
| redox enzymes that act in conjunction with CAZymes, Auxiliary Activities: AA7 | 2.69E-31 | gene family |
miiRNA targets
| Gene ID | Expection | Align sequence(miRNA-target) | Annotation |
|---|
| CRO_T001508 | 1.5 | | | ncRNA: | 21 | GUAGUUGCGACGUGAGUUACU | 1 | | | | | =||||||||||||||||||*| | | | | targets: | 1155 | UAUCAACGCUGCACUCAAUCA | 1175 |
| laccase |
| CRO_T004377 | 1 | | | ncRNA: | 21 | GUAGUUGCGACGUGAGUUACU | 1 | | | | | *||=||||||||||||||||| | | | | targets: | 2346 | GAUUAACGCUGCACUCAAUGA | 2366 |
| Laccase/Diphenol oxidase family protein |
| CRO_T005813 | 1.5 | | | ncRNA: | 21 | GUAGUUGCGACGUGAGUUACU | 1 | | | | | *||||||||||||||*||||| | | | | targets: | 1432 | GAUCAACGCUGCACUAAAUGA | 1452 |
| laccase |
| CRO_T006406 | 1.5 | | | ncRNA: | 21 | GUAGUUGCGACGUGAGUUACU | 1 | | | | | ||||||||||||||||||*|| | | | | targets: | 1020 | CAUCAACGCUGCACUCAACGA | 1040 |
| laccase |
| CRO_T006720 | 1.5 | | | ncRNA: | 21 | GUAGUUGCGACGUGAGUUACU | 1 | | | | | ||||||||||||||||||*|| | | | | targets: | 117 | CAUCAACGCUGCACUCAACGA | 137 |
| laccase |
| CRO_T008150 | 2.5 | | | ncRNA: | 21 | GUAGUUGCGACGUGAGUUACU | 1 | | | | | =|||||=||||||||||||*| | | | | targets: | 2016 | UAUCAAUGCUGCACUCAAUAA | 2036 |
| laccase |
| CRO_T015448 | 1.5 | | | ncRNA: | 21 | GUAGUUGCGACGUGAGUUACU | 1 | | | | | *||||||||||||||*||||| | | | | targets: | 2764 | AAUCAACGCUGCACUGAAUGA | 2784 |
| Laccase/Diphenol oxidase family protein |
| CRO_T020739 | 2.5 | | | ncRNA: | 21 | GUAGUUGCGACGUGAGUUACU | 1 | | | | | ||||||=|||||||||||*|| | | | | targets: | 4834 | CAUCAAUGCUGCACUCAACGA | 4854 |
| Laccase/Diphenol oxidase family protein |
| CRO_T027051 | 1.5 | | | ncRNA: | 21 | GUAGUUGCGACGUGAGUUACU | 1 | | | | | *|||||||||||||||||*|| | | | | targets: | 1143 | AAUCAACGCUGCACUCAACGA | 1163 |
| laccase |
| CRO_T027293 | 2.5 | | | ncRNA: | 21 | GUAGUUGCGACGUGAGUUACU | 1 | | | | | ||||||=||||||||||||*| | | | | targets: | 7606 | CAUCAAUGCUGCACUCAAUCA | 7626 |
| laccase |
| CRO_T028037 | 1.5 | | | ncRNA: | 21 | GUAGUUGCGACGUGAGUUACU | 1 | | | | | ||||||||||||||||||*|| | | | | targets: | 18 | CAUCAACGCUGCACUCAACGA | 38 |
| laccase |
| CRO_T028193 | 2.5 | | | ncRNA: | 21 | GUAGUUGCGACGUGAGUUACU | 1 | | | | | *|||||=||||||||=||||| | | | | targets: | 2943 | GAUCAAUGCUGCACUUAAUGA | 2963 |
| laccase |
| CRO_T033445 | 1.5 | | | ncRNA: | 21 | GUAGUUGCGACGUGAGUUACU | 1 | | | | | *||||||||||||||*||||| | | | | targets: | 760 | GAUCAACGCUGCACUGAAUGA | 780 |
| laccase |
Expression profilings
