cro-novel-11's details annotation
|
Protein:
Yellow color--query protein
Green color--interaction proteins.
Interaction line:
Pink--proteins own interaction and positive co-expression relationship with target protein
Blue--proteins own interaction and negative co-expression relationship with target protein
Orange--proteins own interaction and protein-protein relationship with target protein |
| This network produced by cytoscapeweb
|
Module annotation (GSEA enrichment result)
| Function Annotation | FDR | Gene Ontolog |
|---|
| membrane | 0.00784193 | GO:0016020 |
| NADPH binding | 0.012410687 | GO:0070402 |
| 4-hydroxy-tetrahydrodipicolinate reductase | 0.012410687 | GO:0008839 |
| diaminopimelate biosynthetic process | 0.017494818 | GO:0019877 |
| lysine biosynthetic process via diaminopimelate | 0.017494818 | GO:0009089 |
| regulation of signal transduction | 0.017494818 | GO:0009966 |
| glutathione peroxidase activity | 0.019294107 | GO:0004602 |
| endoplasmic reticulum | 0.021480206 | GO:0005783 |
| nuclear envelope | 0.047506028 | GO:0005635 |
| Cytochrome_P450, Cytochrome P450: CYP81F | 0.001950066 | gene family |
| formation of glycosidic bonds, GlycosylTransferases: GTnc | 0.019391533 | gene family |
| L-lysine biosynthesis VI | 0.012654849 | plantCyc |
| vindoline and vinblastine biosynthesis | 0.023723097 | plantCyc |
| Glutathione metabolism | 0.043598764 | KEGG |
| Biosynthesis of amino acids | 0.045208622 | KEGG |
miiRNA targets
| Gene ID | Expection | Align sequence(miRNA-target) | Annotation |
|---|
| CRO_T001707 | 2.5 | | | ncRNA: | 24 | UUACUUACAAUGUUCUCUACAAUA | 1 | | | | | |||||||||||||*|||||||||* | | | | targets: | 6706 | AAUGAAUGUUACAUGAGAUGUUAC | 6729 |
| PA-domain containing subtilase family protein |
| CRO_T004812 | 2.5 | | | ncRNA: | 19 | UACAAUGUUCUCUACAAUA | 1 | | | | | ||||||||=|||||||||* | | | | targets: | 1 | AUGUUACAGGAGAUGUUAC | 19 |
| hypothetical protein |
| CRO_T006873 | 2 | | | ncRNA: | 24 | UUACUUACAAUGUUCUCUACAAUA | 1 | | | | | ||--|||*|||||||||||||||* | | | | targets: | 665 | AA--AAUAUUACAAGAGAUGUUAG | 686 |
| hypothetical protein |
| CRO_T007207 | 0 | | | ncRNA: | 24 | UUACUUACAAUGUUCUCUACAAUA | 1 | | | | | ||--|||||||||||||||||||| | | | | targets: | 1971 | AA--AAUGUUACAAGAGAUGUUAU | 1992 |
| Cytochrome b561/ferric reductase transmembrane with DOMON related domain |
| CRO_T013902 | 1.5 | | | ncRNA: | 24 | UUACUUACAAUGUUCUCUACAAUA | 1 | | | | | |||*|||||||||||||||*|||| | | | | targets: | 6307 | AAUAAAUGUUACAAGAGAUAUUAU | 6330 |
| cytochrome P450, family 91, subfamily A, polypeptide |
| CRO_T022179 | 1.5 | | | ncRNA: | 24 | UUACUUACAAUGUUCUCUACAAUA | 1 | | | | | |=|-|||||||||||||||||*|| | | | | targets: | 1071 | AGU-AAUGUUACAAGAGAUGUCAU | 1093 |
| microsomal glutathione s-transferase, putative |
| CRO_T026608 | 2.5 | | | ncRNA: | 24 | UUACUUACAAUGUUCUCUACAAUA | 1 | | | | | **|***|||||||=|||||||||| | | | | targets: | 2816 | UCUUUCUGUUACAGGAGAUGUUAU | 2839 |
| SPX domain gene |
| CRO_T029110 | 2 | | | ncRNA: | 24 | UUACUUACAAUGUUCUCUACAAUA | 1 | | | | | *||-||||||*||||||||||||* | | | | targets: | 4144 | CAU-AAUGUUUCAAGAGAUGUUAC | 4166 |
| ubiquitin-protein ligases |
| CRO_T029224 | 2.5 | | | ncRNA: | 24 | UUACUUACAAUGUUCUCUACAAUA | 1 | | | | | *|*|||*|||||||*||||||||| | | | | targets: | 4276 | UAGGAAGGUUACAAAAGAUGUUAU | 4299 |
| Dihydrodipicolinate reductase, bacterial/plant |
| CRO_T031304 | 2.5 | | | ncRNA: | 24 | UUACUUACAAUGUUCUCUACAAUA | 1 | | | | | |=*||=||||||||||*||||||| | | | | targets: | 1412 | AGAGAGUGUUACAAGAAAUGUUAU | 1435 |
| nodulin MtN21 /EamA-like transporter family protein |
| CRO_T031738 | 2 | | | ncRNA: | 24 | UUACUUACAAUGUUCUCUACAAUA | 1 | | | | | ||*||*|||||||||||||||||* | | | | targets: | 2926 | AAAGAUUGUUACAAGAGAUGUUAG | 2949 |
| Protein of unknown function (DUF604) |
Expression profilings
