cro-novel-112's details annotation
Protein:
Yellow color--query protein
Green color--interaction proteins.
Interaction line:
Pink--proteins own interaction and positive co-expression relationship with target protein
Blue--proteins own interaction and negative co-expression relationship with target protein
Orange--proteins own interaction and protein-protein relationship with target protein
This network produced by cytoscapeweb

Module annotation (GSEA enrichment result)

Function AnnotationFDRGene Ontolog
photosystem II0.009748602GO:0009523
intracellular part0.014362615GO:0044424
ligase activity0.025201778GO:0016874
nucleic acid binding0.044641451GO:0003676
Transcription_related, Transcription regulator: Coactivator p150.000177342gene family
photosynthesis light reactions0.002569402plantCyc
Photosynthesis 0.006635972KEGG
Photosynthesis 0.008136033KEGG

miiRNA targets

Gene IDExpectionAlign sequence(miRNA-target)Annotation
CRO_T0225062
 ncRNA:24GUAC-AAGGAAAACUAAGACAGGAA1
   ||*|-||=||||||||||||||||* 
 targets:679CACGCUUUCUUUUGAUUCUGUCCUG703
transcriptional coactivator p15 (PC4) family protein (KELP)
CRO_T0320892.5
 ncRNA:24GU--ACAAGGAAAACUAAGACAGGAA1
   ||--||||||*||||||||*|||||| 
 targets:6118CACUUGUUCCAUUUGAUUCCGUCCUU6143
Peroxidase superfamily protein
CRO_T0326412
 ncRNA:24GU-ACAAGGAAAACUAAGACAGGAA1
   ||-|*|||**||||||||||||||| 
 targets:731CACUCUUCACUUUGAUUCUGUCCUU755
photosystem II reaction center W

Expression profilings


Show more details about the miRNA target expression profiles
TOP