cro-novel-16's details annotation
Protein:
Yellow color--query protein
Green color--interaction proteins.
Interaction line:
Pink--proteins own interaction and positive co-expression relationship with target protein
Blue--proteins own interaction and negative co-expression relationship with target protein
Orange--proteins own interaction and protein-protein relationship with target protein
This network produced by cytoscapeweb

Module annotation (GSEA enrichment result)

Function AnnotationFDRGene Ontolog
Transcription_related, Transcription regulator: ARID0.000325155gene family

miiRNA targets

Gene IDExpectionAlign sequence(miRNA-target)Annotation
CRO_T0082050
 ncRNA:24UUACAGUAUGGUCUCUAAUCUCCU1
   |||||||||||||||||||||||| 
 targets:3530AAUGUCAUACCAGAGAUUAGAGGA3553
ARID/BRIGHT DNA-binding domain-containing protein

Expression profilings


Show more details about the miRNA target expression profiles
TOP