cro-novel-3's details annotation
|
Protein:
Yellow color--query protein
Green color--interaction proteins.
Interaction line:
Pink--proteins own interaction and positive co-expression relationship with target protein
Blue--proteins own interaction and negative co-expression relationship with target protein
Orange--proteins own interaction and protein-protein relationship with target protein |
| This network produced by cytoscapeweb
|
Module annotation (GSEA enrichment result)
| Function Annotation | FDR | Gene Ontolog |
|---|
| Ran GTPase binding | 0.015570364 | GO:0008536 |
| protein import into nucleus | 0.015570364 | GO:0006606 |
| protein transporter activity | 0.017993436 | GO:0008565 |
| nuclear envelope | 0.01947705 | GO:0005635 |
| signal transduction | 0.027791646 | GO:0007165 |
| Ubiquitin_Proteasome_system, E3 adaptor: F-box | 0.048815855 | gene family |
| MAPK signaling pathway - fly | 0.001653966 | KEGG |
miiRNA targets
| Gene ID | Expection | Align sequence(miRNA-target) | Annotation |
|---|
| CRO_T002796 | 2.5 | | | ncRNA: | 23 | GUAAAUAGAUGUUACAAUAGCCA | 1 | | | | | |||||||=||||||*|||||||| | | | | targets: | 197 | CAUUUAUUUACAAUUUUAUCGGU | 219 |
| hypothetical protein |
| CRO_T005461 | 2.5 | | | ncRNA: | 23 | GUAAAUAGAUGUUACAAUAGCCA | 1 | | | | | =*|||||=|||||||||||||*| | | | | targets: | 13962 | UUUUUAUUUACAAUGUUAUCGUU | 13984 |
| ARM repeat superfamily protein |
| CRO_T006873 | 2.5 | | | ncRNA: | 23 | GUAAAUAGAUGUUACAAUAGCCA | 1 | | | | | =||||||=||||||*|||||||| | | | | targets: | 934 | UAUUUAUUUACAAUUUUAUCGGU | 956 |
| hypothetical protein |
| CRO_T007758 | 2.5 | | | ncRNA: | 23 | GUAAAUAGAUGUUACAAUAGCCA | 1 | | | | | |||||||=||||||*|||||||| | | | | targets: | 346 | CAUUUAUUUACAAUUUUAUCGGU | 368 |
| hypothetical protein |
| CRO_T011733 | 1 | | | ncRNA: | 23 | GUAAAUAGAUGUUACAAUAGCCA | 1 | | | | | |||||||=||||||||||||||| | | | | targets: | 1459 | CAUUUAUUUACAAUGUUAUCGGU | 1481 |
| hypothetical protein |
| CRO_T020833 | 2.5 | | | ncRNA: | 23 | GUAAAUAGAUGUUACAAUAGCCA | 1 | | | | | |||||||=||||||*|||||||| | | | | targets: | 3393 | CAUUUAUUUACAAUUUUAUCGGU | 3415 |
| F-box family protein |
| CRO_T022441 | 2.5 | | | ncRNA: | 23 | GUAAAUAGAUGUUACAAUAGCCA | 1 | | | | | |*|||||=|||||||||||||*| | | | | targets: | 378 | CUUUUAUUUACAAUGUUAUCGUU | 400 |
| hypothetical protein |
| CRO_T025738 | 2.5 | | | ncRNA: | 23 | GUAAAUAGAUGUUACAAUAGCCA | 1 | | | | | |||||||=||||||*|||||||| | | | | targets: | 2216 | CAUUUAUUUACAAUUUUAUCGGU | 2238 |
| hypothetical protein |
Expression profilings
