cro-novel-42's details annotation
|
Protein:
Yellow color--query protein
Green color--interaction proteins.
Interaction line:
Pink--proteins own interaction and positive co-expression relationship with target protein
Blue--proteins own interaction and negative co-expression relationship with target protein
Orange--proteins own interaction and protein-protein relationship with target protein |
| This network produced by cytoscapeweb
|
Module annotation (GSEA enrichment result)
| Function Annotation | FDR | Gene Ontolog |
|---|
| phosphatidylinositol-mediated signaling | 0.008617463 | GO:0048015 |
| 1-phosphatidylinositol 4-kinase activity | 0.010119962 | GO:0004430 |
| phosphatidylinositol phosphorylation | 0.014757954 | GO:0046854 |
| single-organism metabolic process | 0.020873759 | GO:0044710 |
| metal ion binding | 0.025893305 | GO:0046872 |
| protein dephosphorylation | 0.026954079 | GO:0006470 |
| protein serine/threonine phosphatase activity | 0.028597049 | GO:0004722 |
| oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen | 0.044197395 | GO:0016705 |
| monooxygenase activity | 0.044197395 | GO:0004497 |
| D-myo-inositol (1,4,5)-trisphosphate biosynthesis | 0.007963644 | plantCyc |
| 3-phosphoinositide biosynthesis | 0.007963644 | plantCyc |
| mRNA surveillance pathway | 0.018529184 | KEGG |
| Inositol phosphate metabolism | 0.018529184 | KEGG |
miiRNA targets
| Gene ID | Expection | Align sequence(miRNA-target) | Annotation |
|---|
| CRO_T001584 | 2 | | | ncRNA: | 24 | CAUGUGUUUCACCAUGUCUCUUAG | 1 | | | | | |||||||*|*|||||||||||||| | | | | targets: | 2894 | GUACACACAAUGGUACAGAGAAUC | 2917 |
| type one serine/threonine protein phosphatase |
| CRO_T002883 | 1.5 | | | ncRNA: | 24 | CAUGUGUUUCACCAUGUCUCUUAG | 1 | | | | | ||||||||||||||||||||=||| | | | | targets: | 1234 | GUACACAAAGUGGUACAGAGGAUC | 1257 |
| cytochrome P450, family 71, subfamily B, polypeptide |
| CRO_T020015 | 1 | | | ncRNA: | 24 | CAUGUGUUUCACCAUGUCUCUUAG | 1 | | | | | *||=|=|||||||||||||||||| | | | | targets: | 5824 | UUAUAUAAAGUGGUACAGAGAAUC | 5847 |
| Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein |
| CRO_T022252 | 2.5 | | | ncRNA: | 24 | CAUGUGUUUCACCAUGUCUCUUAG | 1 | | | | | ||||||*|||||||||||||=||| | | | | targets: | 7874 | GUACACCAAGUGGUACAGAGGAUC | 7897 |
| phosphatidylinositol 4-OH kinase beta1 |
| CRO_T029531 | 2.5 | | | ncRNA: | 24 | CAUGUGUUUCACCAUGUCUCUUAG | 1 | | | | | ||||||||||||||||||||*||= | | | | targets: | 11513 | GUACACAAAGUGGUACAGAGUAUU | 11536 |
| Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase family protein |
Expression profilings
