cro-novel-49's details annotation
|
Protein:
Yellow color--query protein
Green color--interaction proteins.
Interaction line:
Pink--proteins own interaction and positive co-expression relationship with target protein
Blue--proteins own interaction and negative co-expression relationship with target protein
Orange--proteins own interaction and protein-protein relationship with target protein |
| This network produced by cytoscapeweb
|
Module annotation (GSEA enrichment result)
| Function Annotation | FDR | Gene Ontolog |
|---|
| AP-5 adaptor complex | 0.00590903 | GO:0044599 |
| hydrolase activity, hydrolyzing O-glycosyl compounds | 0.008582465 | GO:0004553 |
| respiratory electron transport chain | 0.026560403 | GO:0022904 |
| sugar transmembrane transporter activity | 0.03834694 | GO:0051119 |
| carbohydrate transport | 0.045579738 | GO:0008643 |
| hydrolysis and/or rearrangement of glycosidic bonds, Glycoside Hydrolases: GHnc | 0.020153136 | gene family |
| Transcription_related, Transcription factor: HB | 0.039416078 | gene family |
| PI3K-Akt signaling pathway | 0.00283357 | KEGG |
miiRNA targets
| Gene ID | Expection | Align sequence(miRNA-target) | Annotation |
|---|
| CRO_T006873 | 2 | | | ncRNA: | 24 | UGUCAUUUAUAAUGUCUCCUAGGC | 1 | | | | | =*=**||||=|||||||||||||* | | | | targets: | 686 | GAGAAAAAUGUUACAGAGGAUCCU | 709 |
| hypothetical protein |
| CRO_T008146 | 2.5 | | | ncRNA: | 24 | UGUCAUUUAUAAUGUCUCCUAGGC | 1 | | | | | |||--||||=|||||*|||||||| | | | | targets: | 1398 | ACA--AAAUGUUACAAAGGAUCCG | 1419 |
| PPPDE putative thiol peptidase family protein |
| CRO_T011669 | 3 | | | ncRNA: | 24 | UGUCAUUUAUAAUGUCUCCUAGGC | 1 | | | | | ||=|*|*||=|||||||||||||* | | | | targets: | 3261 | ACGGAAUAUGUUACAGAGGAUCCU | 3284 |
| BEL1-like homeodomain |
| CRO_T012592 | 2.5 | | | ncRNA: | 24 | UGUCAUUUAUAAUGUCUCCUAGGC | 1 | | | | | ||=|*||||=|||||||*|||||| | | | | targets: | 5187 | ACGGGAAAUGUUACAGAUGAUCCG | 5210 |
| hypothetical protein |
| CRO_T016538 | 1.5 | | | ncRNA: | 24 | UGUCAUUUAUAAUGUCUCCUAGGC | 1 | | | | | |||--|||||||||||||||||=| | | | | targets: | 2361 | ACA--AAAUAUUACAGAGGAUCUG | 2382 |
| smr (Small MutS Related) domain-containing protein |
| CRO_T024735 | 3 | | | ncRNA: | 24 | UGUCAUUUAUAAUGUCUCCUAGGC | 1 | | | | | |||--||=||*||||||||||||* | | | | targets: | 5282 | ACA--AAGUAGUACAGAGGAUCCU | 5303 |
| hypothetical protein |
| CRO_T026111 | 2.5 | | | ncRNA: | 24 | UGUCAUUUAUAAUGUCUCCUAGGC | 1 | | | | | |=|**||||=|||||||*|||||| | | | | targets: | 9173 | AUAAAAAAUGUUACAGACGAUCCG | 9196 |
| DUF4079 domain containing protein |
| CRO_T026146 | 2.5 | | | ncRNA: | 24 | UGUCAUUUAUAAUGUCUCCUAGGC | 1 | | | | | |=||*||||=|||||||*|||||| | | | | targets: | 1356 | AUAGGAAAUGUUACAGAAGAUCCG | 1379 |
| Cellulase (glycosyl hydrolase family 5) protein |
| CRO_T028269 | 2.5 | | | ncRNA: | 24 | UGUCAUUUAUAAUGUCUCCUAGGC | 1 | | | | | |==--||||=|||||*|||||||| | | | | targets: | 2222 | AUG--AAAUGUUACAAAGGAUCCG | 2243 |
| Carbohydrate-binding X8 domain superfamily protein |
| CRO_T030975 | 2.5 | | | ncRNA: | 24 | UGUCAUUUAUAAUGUCUCCUAGGC | 1 | | | | | |=|**=|||||||||*|||||||| | | | | targets: | 7057 | AUAAAGAAUAUUACAUAGGAUCCG | 7080 |
| AP-5 complex subunit, vesicle trafficking domain containing protein |
| CRO_T031150 | 0 | | | ncRNA: | 24 | UGUCAUUUAUAAUGUCUCCUAGGC | 1 | | | | | |||**||||||||||||||||||| | | | | targets: | 2406 | ACAUAAAAUAUUACAGAGGAUCCG | 2429 |
| Nodulin MtN3 family protein |
| CRO_T032280 | 2.5 | | | ncRNA: | 24 | UGUCAUUUAUAAUGUCUCCUAGGC | 1 | | | | | |*||*||||=|||||||*|||||| | | | | targets: | 2653 | AAAGGAAAUGUUACAGAAGAUCCG | 2676 |
| MATE efflux family protein |
Expression profilings
