cro-novel-7's details annotation
|
Protein:
Yellow color--query protein
Green color--interaction proteins.
Interaction line:
Pink--proteins own interaction and positive co-expression relationship with target protein
Blue--proteins own interaction and negative co-expression relationship with target protein
Orange--proteins own interaction and protein-protein relationship with target protein |
| This network produced by cytoscapeweb
|
Module annotation (GSEA enrichment result)
| Function Annotation | FDR | Gene Ontolog |
|---|
| phospholipid transport | 0.003250591 | GO:0015914 |
| formate-tetrahydrofolate ligase activity | 0.004344485 | GO:0004329 |
| folic acid-containing compound biosynthetic process | 0.004873581 | GO:0009396 |
| carbohydrate transport | 0.008383967 | GO:0008643 |
| sugar transmembrane transporter activity | 0.020615576 | GO:0051119 |
| folate polyglutamylation | 0.006763663 | plantCyc |
| folate transformations II | 0.006763663 | plantCyc |
| tetrahydrofolate biosynthesis II | 0.006763663 | plantCyc |
| MAPK signaling pathway - plant | 0.048454284 | KEGG |
miiRNA targets
| Gene ID | Expection | Align sequence(miRNA-target) | Annotation |
|---|
| CRO_T007160 | 2.5 | | | ncRNA: | 24 | CAAUGUUCUUUAUAAUGUCUCCUA | 1 | | | | | |||||||*||||=||||||||||| | | | | targets: | 8821 | GUUACAAAAAAUGUUACAGAGGAU | 8844 |
| 10-formyltetrahydrofolate synthetase |
| CRO_T009769 | 2.5 | | | ncRNA: | 24 | CAAUGUUCUUUAUAAUGUCUCCUA | 1 | | | | | |||||=|||||||||||||||*|| | | | | targets: | 2322 | GUUACGAGAAAUAUUACAGAGAAU | 2345 |
| CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily pr |
| CRO_T020935 | 2.5 | | | ncRNA: | 24 | CAAUGUUCUUUAUAAUGUCUCCUA | 1 | | | | | ||||*|=|||||||||||*||||| | | | | targets: | 12150 | GUUAAAGGAAAUAUUACAUAGGAU | 12173 |
| golgin candidate |
| CRO_T031150 | 2 | | | ncRNA: | 24 | CAAUGUUCUUUAUAAUGUCUCCUA | 1 | | | | | ||||||**|||||||||||||||| | | | | targets: | 2403 | GUUACAUAAAAUAUUACAGAGGAU | 2426 |
| Nodulin MtN3 family protein |
| CRO_T033107 | 0 | | | ncRNA: | 24 | CAAUGUUCUUUAUAAUGUCUCCUA | 1 | | | | | ||||*||||||||||||||||||| | | | | targets: | 6389 | GUUAAAAGAAAUAUUACAGAGGAU | 6412 |
| aminophospholipid ATPase |
Expression profilings
